yurJ [2017-12-15 09:37:38]

aminosugar ABC transporter (ATP-binding protein)

Locus: BSU32550

Isoelectric point: 6.07

Molecular weight: 41.19 kDa

Protein length: 367 aa

Gene length: 1101 bp

Function: uptake of sugar amines

Product: aminosugar ABC transporter (ATP-binding protein)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of carbon sources
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of amino sugars
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of nitrogen sources other than amino acids → Utilization of amino sugars
• Groups of genes → Membrane proteins
• Groups of genes → Phosphoproteins → Phosphorylation on a Ser residue

Gene

Coordinates: 3,345,013 → 3,346,116

The protein

Modification

• phosphorylated on Ser-3 PubMed

Localization

• membrane associated (via FrlM-FrlN) PubMed

Expression and Regulation

Operons

• Genes: yurJ
  Description: PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in CodY regulon

• Genes: frlB-frlO-frlN-frlM-frlD-yurJ
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CodY: repression, PubMed, PubMed, in CodY regulon
  • FrlR: repression, PubMed, in FrlR regulon
  • YlxR: regulation, PubMed, in YlxR regulon

  Regulation

  • FrlB: repressed during growth in the presence of branched chain amino acids (CodY) PubMed
  • induced in the absence of YlxR PubMed

  Additional information

  • the frlB-frlO-frlN-frlM-frlD-yurJ operon is strongly downregulated in a cshA mutant PubMed

Biological materials

Mutant

• MGNA-A556 (yurJ::erm), available at the NBRP B. subtilis, Japan
• BKE32550 (ΔyurJ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCAGAAAAGTCCCCCTAT, downstream forward: _UP4_TAGAAAAAGGTGCTCCTCAA
• BKK32550 (ΔyurJ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCAGAAAAGTCCCCCTAT, downstream forward: _UP4_TAGAAAAAGGTGCTCCTCAA

References

Loading